Table 1

AMR targeted qPCR primers

AMR geneOligonucleotide sequence
ForwardReverse
blaTEM AGCATCTTACGGATGGCATGATCCTCCGATCGTTGTCAGAAGT
ErmB TAAAGGGCATTTAACGACGAAACTTTTATACCTCTGTTTGTTAGGGAATTGAA
mefA CCGTAGCATTGGAACAGCTTTTAAACGGAGTATAAGAGTGCTGCAA
tetM TAATATTGGAGTTTTAGCTCATGTTGATGCCTCTCTGACGTTCTAAAAGCGTATTAT
AcrA-05 CGTGCGCGAACGAACAACTTTGCGCGCCATCTTC
AMPc-04 TCCGGTGACCGCACAGACAGCACGCCGGTGAAAGT
cfx-A TCATTCCTCGTTCAAGTTTTCAGATGCAGCACCAAGAGGAGATGT
FOX-5 GGTTTGCCGCTGCAGTTCGCGGCCAGGTGACCAA
PBP2X TTTCATAAGTATCTGGACATGGAAGAACCAAAGGAAACTTGCTTGAGATTAG
TetA-01 GCTGTTTGTTCTGCCGGAAAGGTTAAGTTCCTTGAACGCAAACT
  • AMR, antimicrobial resistance; qPCR, quantitative PCR.